ID: 1046376566

View in Genome Browser
Species Human (GRCh38)
Location 8:113389831-113389853
Sequence CTCACTTTTCAAAGAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046376566_1046376570 3 Left 1046376566 8:113389831-113389853 CCCTTCCCTCTTTGAAAAGTGAG 0: 1
1: 0
2: 8
3: 28
4: 351
Right 1046376570 8:113389857-113389879 AGTAAAAGTGCCCACCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046376566 Original CRISPR CTCACTTTTCAAAGAGGGAA GGG (reversed) Intronic
900802479 1:4745951-4745973 TTCATTTTGCAAAGAGGAAAGGG - Intronic
900856315 1:5187758-5187780 CCCAATTGTCAAAGAAGGAAGGG - Intergenic
901300199 1:8194731-8194753 GTCACTGTTCAAACAAGGAAGGG - Intergenic
901877352 1:12174549-12174571 CCTACTTTTCAAAGAAGAAATGG - Intronic
904032187 1:27540179-27540201 TCCAGTTTACAAAGAGGGAAAGG - Intronic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
907289757 1:53406198-53406220 CTCACTTTTTAAAAAAGGGATGG - Intergenic
908062859 1:60370840-60370862 CTCACTTATCACAAAGGGCATGG - Intergenic
908551677 1:65214658-65214680 CTCACTTTTGAAATAGTGAGTGG + Intronic
909218010 1:72916424-72916446 ATCACTTTTCAAAGAATAAATGG + Intergenic
910459391 1:87432666-87432688 CTCACTTTTAAAAGCCTGAATGG - Intergenic
910705174 1:90122083-90122105 CTCACTTTCCTATGTGGGAAGGG - Intergenic
912987421 1:114448387-114448409 TTGACATTTAAAAGAGGGAAAGG + Intronic
913324198 1:117612227-117612249 CACATTTTTGAAAGAGTGAAAGG + Intronic
913606800 1:120474835-120474857 GACACTGTTCAAAGAGGGACAGG + Intergenic
913988542 1:143586790-143586812 AACACTGTCCAAAGAGGGAAAGG - Intergenic
914316624 1:146519009-146519031 CTCACTTTTAAAAGCCTGAATGG - Intergenic
914411866 1:147437070-147437092 CTCTCTCTCCAAAGAGGGTAGGG + Intergenic
914497732 1:148214352-148214374 CTCACTTTTAAAAGCCTGAATGG + Intergenic
915853971 1:159361404-159361426 CTCACCTCTTAATGAGGGAATGG - Intergenic
917759476 1:178141078-178141100 CTCACTTATCACCAAGGGAATGG + Intronic
919143939 1:193609412-193609434 CTCACTTTCCAAATTGGAAAAGG - Intergenic
919232241 1:194789184-194789206 CTTACTTTCCAAAGAGTAAAGGG - Intergenic
919311201 1:195912222-195912244 GTCACTTTCCAAATAGAGAAGGG + Intergenic
919399930 1:197100272-197100294 AACATTTTTGAAAGAGGGAAAGG - Intronic
919793839 1:201309266-201309288 CCCACTTCTCCAAGAAGGAAGGG + Intronic
920257537 1:204665672-204665694 CTCACTTTTCAAAGGGACAGTGG + Intronic
920788169 1:209062641-209062663 CTCTATTTGCAAAGAGGGACTGG + Intergenic
920861592 1:209712594-209712616 CTCAGTATTCAAAGGGGGATTGG - Intronic
921415569 1:214882514-214882536 CTAACTTTTAAAATAGGCAAAGG + Intergenic
921745578 1:218736907-218736929 CTCACTTCTGAAAGAAGAAAAGG + Intergenic
921832965 1:219748823-219748845 CCCACCATTCAAAAAGGGAAGGG + Intronic
921983039 1:221279481-221279503 TTCTCTTGTCAAAGAGGGAAAGG + Intergenic
922743870 1:228032123-228032145 CTCACTTGCCAAAGCGGGGAGGG + Intronic
923065158 1:230510619-230510641 CCCTCTCTTCTAAGAGGGAAAGG + Intergenic
923438893 1:233996589-233996611 GGCACATTCCAAAGAGGGAAGGG - Intronic
923682022 1:236126143-236126165 CTTGCTCTTCAAAGAGGGAGAGG - Intergenic
923707357 1:236355001-236355023 CTTTCTCTTCAAAGAGGGAAAGG - Intronic
923879579 1:238088687-238088709 CTCTGTCTCCAAAGAGGGAAAGG + Intergenic
924199410 1:241643211-241643233 CTCACTTATCACAAAGGGGATGG - Intronic
924798398 1:247309523-247309545 CTGACTTTTCATAGAAAGAATGG - Intronic
1063308645 10:4931859-4931881 CTCAAATTTCAAAGAGGTAGTGG + Intronic
1063318031 10:5025607-5025629 CTCAAATTTCAAACAGGGAGTGG - Intronic
1064365792 10:14706687-14706709 CTCACTCTTTGAAGAGGGGAAGG - Intronic
1064503584 10:16004026-16004048 CTCAATTTTAAAAAAGGCAAAGG + Intergenic
1066063431 10:31744500-31744522 CTCACTATACAATGAGGGCAGGG + Intergenic
1068319594 10:55394064-55394086 CTCTCTCTTCAAAGAGGGAAGGG - Intronic
1068432152 10:56947805-56947827 CTCACTTATCACCAAGGGAATGG - Intergenic
1069174748 10:65277253-65277275 CTCTCTTTTCTAAGAAGGGAAGG - Intergenic
1069638327 10:69939078-69939100 CTCACTTTTGATAGAGGCATGGG + Intronic
1069834444 10:71299712-71299734 TTGACTCTTCAAAGAGGAAAAGG - Exonic
1070663819 10:78329234-78329256 CTCACGTGTCTAAGAGAGAATGG - Intergenic
1072558033 10:96540326-96540348 TTTACTTTTCCAGGAGGGAAAGG - Intronic
1074360788 10:112822787-112822809 CTCATGCTTCAAACAGGGAAAGG - Intergenic
1074923945 10:118047316-118047338 CGGACTTTTCAAAAAGAGAAGGG - Intergenic
1075414469 10:122252302-122252324 CTCATTTTTCAGTGAGGAAATGG - Intronic
1075598520 10:123749743-123749765 CTGACTTTACAAAGGGTGAAAGG - Intronic
1075839867 10:125492098-125492120 CTGTCCTTTCACAGAGGGAAAGG - Intergenic
1076543282 10:131227809-131227831 CTCATTTTTTAAACAGGAAAGGG + Intronic
1078936324 11:15954057-15954079 CTCACTTATCACCAAGGGAACGG + Intergenic
1079636703 11:22751287-22751309 CTGAATTTTAAAAGATGGAAAGG - Intronic
1079796765 11:24813581-24813603 CTCACTTGTCAACAAGGGGATGG + Intronic
1081695296 11:45105403-45105425 CTCATCTATCAGAGAGGGAAAGG + Intronic
1082235240 11:49815384-49815406 CTAAATATTCAAAGAGGGAGAGG + Intergenic
1082947139 11:58772501-58772523 CTGACTTTTCAAAGAGGCATGGG + Intergenic
1084965293 11:72741382-72741404 GTCACCTTTCTAAGTGGGAAGGG - Intronic
1085121147 11:73968441-73968463 CTCACCTTGCCAAGAGGGATGGG - Exonic
1085995448 11:81907382-81907404 CTCACCTTTAAAATTGGGAATGG + Intergenic
1086023002 11:82254897-82254919 CTCTTTCTTCAAAGAGGGGAAGG + Intergenic
1086314208 11:85572963-85572985 CTCACTTATCACCAAGGGAATGG - Intronic
1086728369 11:90218740-90218762 CTCACTTCCCAAACAGGGCAGGG - Intronic
1086915276 11:92522956-92522978 CTCTCTTTTCCAAGAGGGGAAGG - Intronic
1088102486 11:106170621-106170643 TTCACTTTACATAGAAGGAATGG - Intergenic
1088783090 11:113155210-113155232 TTCAATTTTTAAAAAGGGAATGG + Intronic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090924913 11:131241085-131241107 CTTGCTTTTCATAGAGTGAAAGG - Intergenic
1091013385 11:132026779-132026801 CTCACTTTGCAAGAAGGGAACGG + Intronic
1091038072 11:132251823-132251845 CTGGCTTGTCAAAGAGGGGAGGG + Intronic
1092460192 12:8679490-8679512 TGCACATTTCAAAGAAGGAATGG - Intergenic
1092851929 12:12637153-12637175 ATCACTTGTTAAAGAGAGAAAGG + Intronic
1092887032 12:12933876-12933898 CTCTCTCTTCAAAGAGGGGAAGG + Intergenic
1093177525 12:15929199-15929221 CTCCCTTTTTAAAGGTGGAATGG + Intronic
1093559954 12:20526653-20526675 TTCACTTTTCAAAAACTGAATGG - Intronic
1094084492 12:26574869-26574891 CTCACTTATCACCGAGGGGATGG + Intronic
1094326945 12:29250974-29250996 CTCAATTTTCAAAGAGGAGGTGG + Intronic
1095373968 12:41504326-41504348 ATTTCTTTTCAGAGAGGGAAGGG + Intronic
1095511997 12:42961352-42961374 CTCACTTTGTTAAGAGGTAAAGG + Intergenic
1095800374 12:46265992-46266014 GTCACTGCTCAAAGTGGGAAGGG + Intronic
1095854516 12:46845214-46845236 TTCATTTTGCAAACAGGGAATGG - Intergenic
1096346323 12:50850236-50850258 CTCACTTATCACCAAGGGAATGG - Intronic
1096618391 12:52847504-52847526 CTCTGGTTCCAAAGAGGGAAGGG - Intronic
1097373436 12:58812311-58812333 GTTTCCTTTCAAAGAGGGAAGGG + Intronic
1097496751 12:60349203-60349225 CTCACTTTTAACAAAGGAAATGG + Intergenic
1097899106 12:64856231-64856253 CTCACTTATCACCAAGGGAATGG + Intronic
1099250901 12:80252493-80252515 TTCACTTTTTAAAAAAGGAAAGG + Intronic
1100554166 12:95675820-95675842 CTCACTTTTTAAAGACAGATTGG + Intronic
1101215615 12:102578920-102578942 CTCACCTTTAAAGGAGGGAGAGG - Intergenic
1102514030 12:113434710-113434732 CCAACTTTGCAAAGAGGCAATGG - Intronic
1103479411 12:121241458-121241480 CTCCCACTTCCAAGAGGGAAGGG - Intronic
1103932834 12:124459675-124459697 CTCTGCATTCAAAGAGGGAAGGG - Intronic
1104367132 12:128187905-128187927 CTCACTTTTCAGAGACCGGAAGG + Intergenic
1104392021 12:128398924-128398946 CTGAGCTTTCCAAGAGGGAATGG - Intronic
1104460258 12:128950109-128950131 TTCGCTTTTCAAAGTGGGAAAGG - Intronic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1106266667 13:28116631-28116653 GTGACTTTTAAAAGAAGGAAAGG + Intergenic
1106923845 13:34592242-34592264 CTCCCTTTTCAAAGAATGACTGG - Intergenic
1107212784 13:37877547-37877569 CTGATTTTTCACAGAGGGTAAGG + Intergenic
1107385056 13:39899136-39899158 CTTATTTTTCAAGGAAGGAAAGG + Intergenic
1107702461 13:43061718-43061740 CTCACTTATCACCAAGGGAATGG + Intronic
1108705442 13:52981369-52981391 AACCCTCTTCAAAGAGGGAATGG - Intergenic
1109409416 13:61943661-61943683 CTCAATTTTCAAAGACGGAGAGG - Intergenic
1109474300 13:62858156-62858178 CACACTCTTCAAAGAGGGAAGGG - Intergenic
1112167901 13:96939341-96939363 CTCCCTTATAAAAGAGAGAAAGG - Intergenic
1113397980 13:109966294-109966316 CTCACTTTTCCAACGGGGAAAGG + Intergenic
1117407337 14:55417050-55417072 CGCCCTTTCCCAAGAGGGAATGG + Intronic
1117438413 14:55739555-55739577 TTAAGTGTTCAAAGAGGGAAGGG + Intergenic
1117677752 14:58171740-58171762 GTTACTTTTCAGAGAGTGAAGGG - Intronic
1118365425 14:65091305-65091327 CTCGCTTTTTAAAGAGGAAGAGG + Intronic
1119102539 14:71893589-71893611 CCCTCTTCTCAAGGAGGGAAGGG + Intergenic
1121785327 14:96654875-96654897 TTCAGTTTTCCAAGATGGAAAGG - Intergenic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1122367124 14:101200834-101200856 CTCACTCACCAAAGAGGGGATGG - Intergenic
1122458449 14:101875660-101875682 CTCACTTTACAAATGGGGAAAGG + Intronic
1123768803 15:23508730-23508752 CTCAGTCTTCACATAGGGAAGGG - Intergenic
1124078535 15:26469702-26469724 TTCTCTTTTCAAAGACGGGAAGG - Intergenic
1124090378 15:26594148-26594170 CTCTTTATTCAAAGAGGTAAGGG - Intronic
1125372262 15:38991166-38991188 CACACTTTTTAAATATGGAAAGG + Intergenic
1126198418 15:45957110-45957132 CTGACTATTCAATGAGTGAATGG - Intergenic
1127046628 15:55032805-55032827 CAAACTTTTCAAAAAGAGAAAGG + Intergenic
1127545550 15:59991765-59991787 TTTACTTTTTAAAGAGGGGAAGG + Intergenic
1127930850 15:63596380-63596402 CTGGCTTCTCCAAGAGGGAACGG + Intergenic
1127966983 15:63929862-63929884 CTCATTTTACAAGGGGGGAAGGG - Intronic
1128382331 15:67122244-67122266 TTCTCTTTTCTAAGAAGGAAAGG - Intronic
1131950422 15:97675459-97675481 CTCATGTTTCCAACAGGGAAAGG - Intergenic
1132140496 15:99389139-99389161 CTCACTTTTCCAGAAGAGAAGGG - Exonic
1132384985 15:101393927-101393949 CTAAATTTGCAAAGAGGGATAGG + Intronic
1132628736 16:905587-905609 TTGATTTTTTAAAGAGGGAAAGG - Intronic
1132755547 16:1482794-1482816 CTCACTTTTCAGATAGGAAGAGG + Intergenic
1134424476 16:14127042-14127064 CTCATTTTTCAAAGAGGCTTAGG + Intronic
1134555948 16:15164983-15165005 CTCTCTTTTCACAAAGGGGATGG + Intergenic
1134916531 16:18076718-18076740 CTCTCTTTTCACAAAGGGGATGG + Intergenic
1135904655 16:26500153-26500175 GTCACTTATCAGAGAGGAAAGGG + Intergenic
1136125069 16:28173391-28173413 CTCATTTTACAAAGAAAGAAAGG + Intronic
1138190427 16:55009657-55009679 CACACTCTTCATAGAGTGAAGGG - Intergenic
1138685441 16:58721181-58721203 CTGGCTTTTCAGAGGGGGAAGGG + Intronic
1138755575 16:59480382-59480404 CCCACTTTTCAAAGATAGAGTGG + Intergenic
1139020587 16:62743945-62743967 CTGAGTCTTCAAAGAGTGAAGGG - Intergenic
1139257905 16:65560698-65560720 TGCATTTTACAAAGAGGGAAGGG - Intergenic
1139318510 16:66093883-66093905 CTCTCTTTGCCTAGAGGGAATGG - Intergenic
1140067173 16:71621470-71621492 CTCACTTATCAACAATGGAATGG + Intergenic
1143796377 17:9340243-9340265 CTCATTTATCAAAGCTGGAAAGG + Intronic
1144272598 17:13632700-13632722 GTCACTCTTCAAACAAGGAAGGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150826551 17:68481162-68481184 CTAAGCTTTCAAAGAGGAAAGGG - Intergenic
1151046149 17:70921824-70921846 ATCACGTTTCAAAGGGGGAGAGG - Intergenic
1151094775 17:71484324-71484346 TTCACTTTTCTACAAGGGAAAGG + Intergenic
1151782174 17:76254345-76254367 GGCACATTCCAAAGAGGGAAGGG - Intergenic
1153803850 18:8694932-8694954 CTCACTCATCACTGAGGGAATGG - Intergenic
1155840903 18:30641231-30641253 CTCTCTCTTCAAAAAGGGGAAGG - Intergenic
1156894692 18:42232301-42232323 TTCACTTTTCAAAAGGGAAAAGG + Intergenic
1157848821 18:51029239-51029261 CTTTCTGGTCAAAGAGGGAATGG + Intronic
1159537968 18:69738990-69739012 TTCACTTTTCAAACAAGGGAAGG + Exonic
1160174821 18:76584498-76584520 CTCACTTTTCATAGGTGGAGAGG - Intergenic
1163981431 19:20904028-20904050 CTCACTCTTCACAGTGGCAATGG + Intergenic
1164904444 19:31955509-31955531 CTACCTTTTCCAAGATGGAAGGG - Intergenic
1164991366 19:32686835-32686857 CTCTCTCTTCAAAGAGGGAAAGG + Intergenic
1165604755 19:37092349-37092371 CCCACTTTCAAAAGAGGGAATGG + Intronic
1165876291 19:39009617-39009639 CTCAGTTTTCAAATGGGCAAAGG - Intronic
1168270059 19:55245038-55245060 CCCACTTTTAAAAGAGGAATTGG - Intronic
927393305 2:22620803-22620825 GTCATTTTTCAATGATGGAATGG + Intergenic
928025876 2:27738183-27738205 CTCTCTTTTCAAAGATTTAATGG + Intergenic
928244698 2:29617068-29617090 CTTTCTTTTCAAAGAGGGGAAGG - Intronic
929719936 2:44357461-44357483 ATCATTTCTCATAGAGGGAATGG + Intronic
930622827 2:53662111-53662133 CTCACTTAACACTGAGGGAATGG + Intronic
930878084 2:56242528-56242550 TTCACTTTTCACTAAGGGAATGG + Intronic
932637087 2:73399554-73399576 CTCACTTATCACTAAGGGAATGG + Intronic
933513489 2:83270975-83270997 TTCAGTATTTAAAGAGGGAAAGG - Intergenic
933999230 2:87692742-87692764 CTCCCTCTTCAAAGAGGGCAAGG + Intergenic
934874200 2:97899758-97899780 TTCACTTGTCAAATAGGGAAAGG - Intronic
935965092 2:108465025-108465047 CTCACTTTTCACCAAGGGAATGG + Intronic
936294617 2:111258149-111258171 CTCCTTCTTCAAAGAGGGCAAGG - Intergenic
937499897 2:122466875-122466897 CTGGCTTTTAATAGAGGGAAAGG + Intergenic
938106583 2:128535333-128535355 CTCACTTTTAAAAGAAAGAGAGG - Intergenic
940081840 2:149811951-149811973 CTCACTTATCACCGAGGGGATGG - Intergenic
940231334 2:151456379-151456401 TTCATTTTTCAAAGATGGGATGG + Intronic
940323638 2:152402389-152402411 TGCTCTTTTCCAAGAGGGAAAGG - Intronic
940499303 2:154474694-154474716 ATCACTTTGCACAGAGGAAAGGG + Intergenic
941389546 2:164894784-164894806 ATGATTTTTCAAAGAGGCAAAGG + Intergenic
941533134 2:166693589-166693611 CTTAATATTCAAAGAGGGAGAGG - Intergenic
941648468 2:168067318-168067340 CTCACTTATCACCAAGGGAATGG - Intronic
942988308 2:182167603-182167625 CTCTCTCTTCGAAGAGGGAAAGG - Intronic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
943466386 2:188234441-188234463 CTCTCTCTTCGAAAAGGGAAAGG - Intergenic
944090673 2:195906900-195906922 CTTACTATCCAAAGAGGTAATGG - Exonic
945191539 2:207193146-207193168 TGCTCTTTCCAAAGAGGGAAAGG + Intergenic
946455805 2:219825115-219825137 TTCATTTTTCAAAGGAGGAATGG + Intergenic
946965689 2:225035075-225035097 CTGAGTCTTCAAAGAGAGAAGGG + Intronic
946979322 2:225190279-225190301 TTCACTTTTCATATAGGAAAGGG + Intergenic
948013937 2:234672589-234672611 CTCACCTTGCGGAGAGGGAAGGG - Intergenic
1170421661 20:16199560-16199582 ATCACTCTTAAAAGAGGAAAAGG - Intergenic
1171172110 20:23024526-23024548 CTCTCTCTTTGAAGAGGGAAGGG + Intergenic
1171175028 20:23045420-23045442 CTCACTTTTCTAAGGTGGTAGGG - Intergenic
1173318844 20:41969584-41969606 CTCACCTTTCAAAAAGAAAAAGG + Intergenic
1174767256 20:53265727-53265749 GTCACTTTTGAAAGAGAGGAAGG + Intronic
1177285501 21:19043302-19043324 CTAGCTTTTCACTGAGGGAAGGG + Intergenic
1177658885 21:24056615-24056637 CTCACTCATCACAAAGGGAATGG - Intergenic
1178897937 21:36576073-36576095 CTCACTTTGTTAAGAGGGGATGG - Intronic
1184484115 22:44765852-44765874 CTCACTTTTCCAGCAGGCAAGGG + Intronic
1184900176 22:47441693-47441715 CTTGCTTTTCAAAAAGGAAAGGG + Intergenic
949439328 3:4063592-4063614 CTCTCTCTTTGAAGAGGGAAAGG - Intronic
949474535 3:4431080-4431102 TTCCCTTGTCAAATAGGGAATGG - Intronic
949799859 3:7891952-7891974 CTAACTTTGCAAAGAGAAAATGG - Intergenic
949926146 3:9043360-9043382 CTCTCTTTTCCATGAGGGCAGGG + Intronic
951355814 3:21665381-21665403 TTTAGTTTTCAAAGAGGGATGGG - Intronic
952000860 3:28784401-28784423 CTCATTTGTCAAAAAGGGAGGGG - Intergenic
952633634 3:35500921-35500943 CTTGCTTTTCTAAGAGGGAGTGG + Intergenic
953808619 3:46093178-46093200 CCCACTTCTCAAAGAGTCAAAGG - Intergenic
954329630 3:49882772-49882794 CCTTCTCTTCAAAGAGGGAAAGG - Intergenic
954477040 3:50756852-50756874 CACAATTTTTAAATAGGGAAAGG - Intronic
955040694 3:55314918-55314940 CAGACTTTTCACAAAGGGAAAGG + Intergenic
955070892 3:55571723-55571745 CTCACAATTCCAAGAGGGGAAGG - Intronic
955202267 3:56861822-56861844 TTCACTTTTAGAAGAGAGAAAGG - Intronic
955508691 3:59658000-59658022 CTCACTTTGATAAGAGGCAATGG + Intergenic
956322525 3:68013557-68013579 TTCACTTGGCAAATAGGGAAAGG + Intronic
959940637 3:112077343-112077365 CTCACCTTATAAAGAGGGAGAGG + Intronic
960175469 3:114512772-114512794 TTCTTTTTTGAAAGAGGGAATGG + Intronic
960925233 3:122789114-122789136 CTCATTTTTAAAAGGGGCAAAGG - Intronic
961162919 3:124744896-124744918 CTCACTCTCCAAAGAGGGGAAGG + Exonic
962503334 3:136018477-136018499 CTTCGTTTTCAAAGGGGGAAGGG + Intronic
963035435 3:141021424-141021446 CTCACTTTAAAAAGTGGGAATGG - Intergenic
963126012 3:141817248-141817270 CTCAGTTTTCACTGAGGGCAGGG + Exonic
963457205 3:145559157-145559179 CACAATTTTCAAAAAGGCAAAGG - Intergenic
964822259 3:160784473-160784495 CTCACTGTTGAAAGAGAAAATGG + Intronic
965127935 3:164653760-164653782 CTCCCTTTTCTTAGAGGGATGGG - Intergenic
966848927 3:184152502-184152524 TTCACTATTTTAAGAGGGAAGGG + Intronic
969488143 4:7483702-7483724 CTCAGTTTCCCAAGAGGGTACGG - Intronic
970196890 4:13559989-13560011 ATCAATGTTCAAAGAAGGAAAGG + Intergenic
971323063 4:25620962-25620984 CACACTTTTCATATAGGTAATGG + Intergenic
971570880 4:28209524-28209546 CTCACTTGTCATCAAGGGAATGG - Intergenic
971821850 4:31567254-31567276 TTCACTTTTGCAAGAGGAAATGG + Intergenic
972007664 4:34131391-34131413 CTCACTTATCACAAAGGGGATGG - Intergenic
972482834 4:39514366-39514388 CTCATTTTTTAAATAGGGACAGG + Intronic
973629810 4:52810089-52810111 CAAACTTTTTAAAAAGGGAACGG + Intergenic
974231300 4:59118126-59118148 CTCATGTTTTATAGAGGGAAAGG - Intergenic
975543884 4:75541982-75542004 CTCATTTTTCAGAGATGAAATGG - Intronic
976327621 4:83790490-83790512 CTCAACTTTCAAAAAGGGAAGGG - Intergenic
976338226 4:83915699-83915721 CTCACTTTTCAGGTATGGAAGGG - Intergenic
976594578 4:86882904-86882926 CTCTTTCTTCGAAGAGGGAAAGG - Intronic
977578866 4:98703327-98703349 CACAGTTTTAAAAGAAGGAAAGG + Intergenic
977875409 4:102143701-102143723 TTCACCTTTCAGATAGGGAATGG + Intergenic
979278507 4:118838698-118838720 CTCACCTTTCAAATAGGATATGG - Intergenic
979358468 4:119733191-119733213 CTCTCTCTTCAAAGAGGGGAAGG - Intergenic
980807160 4:137828561-137828583 CTGACTTTTTAAAGAAGCAAAGG - Intergenic
981113167 4:140958902-140958924 CCCACTTGTCAAAGAAAGAAAGG - Intronic
982080369 4:151783752-151783774 CTCTCTTTTTGAAGAGGGGAAGG + Intergenic
982474226 4:155830885-155830907 CACACTTTACAAAAACGGAATGG - Intronic
982617076 4:157652344-157652366 CTCACTTATCACAAAGGGCATGG + Intergenic
983252175 4:165357744-165357766 CTCTCTTTCAAAAAAGGGAAGGG - Intergenic
983741465 4:171139622-171139644 CTCTCTCTTCAAAGAGGGGAAGG + Intergenic
984963968 4:185125431-185125453 CTCTCTCTTTGAAGAGGGAAAGG + Intergenic
985200989 4:187485368-187485390 CTCACTTATAAAAGAGGGAAAGG - Intergenic
986201548 5:5583858-5583880 CTCAGTTTTCCAAAAGGGGATGG - Intergenic
987565557 5:19580283-19580305 CCAACTTTTCAAAGATGGGAAGG - Intronic
990490517 5:56298646-56298668 CTTCCTTATCAATGAGGGAAGGG + Intergenic
990846545 5:60146793-60146815 CTCATTTTTTAAAAAGGTAAAGG + Intronic
991169345 5:63603149-63603171 CTCATTATTCAGAGAAGGAAAGG + Intergenic
991191014 5:63873776-63873798 AGCACTTTTTAAATAGGGAAGGG - Intergenic
991246494 5:64513809-64513831 CTCACTGGTCAAATAGTGAAAGG + Intronic
991455991 5:66805147-66805169 CTCATTTTTCAAAGGAGTAAAGG + Intronic
992564506 5:77984735-77984757 CACACTTTTCAGAGAGGAGACGG + Intergenic
992851799 5:80817691-80817713 CTATCTTTTCAAATAGGTAACGG + Intronic
993092736 5:83446762-83446784 CTCCCTTTTGAAAGAGGGCTGGG + Intergenic
994400510 5:99274077-99274099 CTCACTTATCACCAAGGGAATGG - Intergenic
995127720 5:108595556-108595578 CTCACCTGTCAATGAGAGAAGGG - Intergenic
995330796 5:110943843-110943865 CTTCCTTTTCTATGAGGGAAGGG + Intergenic
996805634 5:127451159-127451181 CTGAAATTTCAAAGAAGGAAAGG + Intronic
1000870949 5:166576565-166576587 CTCATTTTGCAATAAGGGAATGG - Intergenic
1001917554 5:175574382-175574404 CTCGCTCTTTGAAGAGGGAAAGG + Intergenic
1003621004 6:7699885-7699907 CTCTCTCTTCAAACAGGGGAAGG - Intergenic
1004658656 6:17689831-17689853 GTAACTTTTCAAAGAAGAAAGGG + Intronic
1007148008 6:39656842-39656864 CTCACCTTCCTAAGAGAGAATGG + Intronic
1008097665 6:47356241-47356263 CTCAATTTTAAAACAGGCAAAGG + Intergenic
1008651839 6:53571763-53571785 CTAATTTTTCATAGAGGAAATGG + Intronic
1008750649 6:54729829-54729851 ATCACTGTTAATAGAGGGAAGGG + Intergenic
1009479031 6:64132498-64132520 GTCTCTTTTCAAAGAAGAAAAGG - Intronic
1012122746 6:95387579-95387601 CTCAGGTTTCAAAGAGGCACTGG + Intergenic
1013549956 6:111197845-111197867 CTCACTTATCACCAAGGGAATGG + Intronic
1013871193 6:114763058-114763080 CTCAGTTTTCACAGAGTAAAAGG + Intergenic
1014740873 6:125146588-125146610 CTCACTTATCAGAAAGGGGATGG - Intronic
1014823891 6:126025880-126025902 TACACTTTTAAAAGAGGGATAGG - Intronic
1014913872 6:127121134-127121156 CACACTTGTCAAGGAGGGACAGG + Intronic
1015120561 6:129696926-129696948 TACACTTCTCAATGAGGGAATGG - Intronic
1015221123 6:130804286-130804308 CAAACTTTTCAAAGAAGGGAAGG - Intergenic
1020335652 7:7060323-7060345 CTCAATATTCAAAGACGGAGAGG - Intergenic
1021117374 7:16759439-16759461 CTCACTTATCACTGAGGGGATGG + Intronic
1022203281 7:28138578-28138600 GACACTTTTCAAAGAGAAAAAGG + Intronic
1022648509 7:32253888-32253910 TTCACTTTTAAAATAGGAAAAGG + Intronic
1023113867 7:36841337-36841359 CTCACTTCTCAAAGAGCTACTGG + Intergenic
1024051061 7:45623788-45623810 CTCCTCTTTCGAAGAGGGAAGGG + Intronic
1026819837 7:73539709-73539731 TTCCCCTTTCACAGAGGGAAGGG - Intronic
1026900141 7:74032554-74032576 CCCACTTTGCAATGAGGAAATGG - Intronic
1027586550 7:80065752-80065774 CTCACTTTTCATCAAGGGGATGG + Intergenic
1028715967 7:93969146-93969168 CTCACTTTTCACCCAGTGAAGGG - Intronic
1029571251 7:101371091-101371113 CTCACATTTCCAAGAGGCAGTGG - Intronic
1029974040 7:104815895-104815917 CTCATTCTTCAAAGGGGAAAGGG - Intronic
1030111122 7:106027819-106027841 CCCACTTTTTAAAAAGGGGATGG + Intronic
1030281140 7:107776798-107776820 CTCACTTTTCAAAATGTAAAAGG + Intronic
1030762912 7:113372974-113372996 ATCTCTTTTCAAAAAGGCAAAGG + Intergenic
1030828772 7:114195128-114195150 GTCACTTTTTACAGAGGGAGAGG + Intronic
1031059135 7:117029413-117029435 CTCATTTTTAAAACAGGCAAAGG - Intronic
1031986794 7:128168665-128168687 CTCACTCTCCAAGGAGGGAAGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032410748 7:131692056-131692078 CCCAGTTTGCAGAGAGGGAACGG - Intergenic
1033053611 7:138029463-138029485 CTCACTTATCACCAAGGGAATGG + Intronic
1033157051 7:138966069-138966091 CTAACATTTGAAAGAGGCAAGGG - Intronic
1035534312 8:379566-379588 CACACTTTTCAAAGGAGGAGAGG + Intergenic
1035832860 8:2716295-2716317 ACCACTTTTCAAAGGAGGAAGGG - Intergenic
1036440784 8:8779913-8779935 CTCTGTGTTCAAAGAGTGAAAGG + Intergenic
1037404443 8:18526475-18526497 CTCTCTCTTCAAAGAGGGAAGGG - Intergenic
1037862304 8:22414168-22414190 GTCACTTATCAAAGAGGGAGGGG - Intronic
1038415956 8:27396190-27396212 TTCACTTTTTAAAAAAGGAATGG + Intronic
1038791750 8:30674193-30674215 CTCGTTTTTCAAAAAGGTAAAGG + Intergenic
1038798070 8:30727228-30727250 CTCACTTGTCCAAGTGGGAGAGG - Intronic
1038806651 8:30799749-30799771 TTCACTTTTCTAACAGGCAAAGG - Exonic
1039027302 8:33271723-33271745 CTCACTTTTCCAGGAGGTGAGGG - Intergenic
1039792916 8:40890150-40890172 CTCACTTCTCTATCAGGGAAAGG + Intronic
1041490787 8:58430588-58430610 TGAACTTTTCAAAGAGGCAAGGG + Exonic
1042152456 8:65802875-65802897 CTCACTTATCAACAAGGGGATGG - Intronic
1043101871 8:76057812-76057834 CTCACTTTTCACCAAGGGGACGG - Intergenic
1043159326 8:76826240-76826262 CTCACTTGTCACCAAGGGAATGG + Intronic
1043507531 8:80917132-80917154 CTCTCTCTTCAAAGAGGGAAAGG + Intergenic
1043601152 8:81939774-81939796 CTCTCTCTTCAAAGAGGGAAAGG - Intergenic
1043880534 8:85537465-85537487 GTAACTTTTCAGTGAGGGAATGG + Intergenic
1043968772 8:86508116-86508138 CACACTTTTCAAAGTCTGAAAGG + Intronic
1044338657 8:91020677-91020699 CTCAATTTTTAAAAAAGGAAAGG + Intronic
1045176725 8:99732988-99733010 CTCACATTTAAAAGGGGGAGGGG + Intronic
1045726752 8:105182885-105182907 CTCACTTTTCACCAAGGGGATGG - Intronic
1045963167 8:107992581-107992603 CACACTGTTCAAAGAGATAATGG + Intronic
1046244848 8:111545764-111545786 CTCTCTCTTCAAAGAGCGGAAGG - Intergenic
1046307124 8:112383728-112383750 CTCTCTTTTCCAAGGGGGATTGG - Intronic
1046376566 8:113389831-113389853 CTCACTTTTCAAAGAGGGAAGGG - Intronic
1047072634 8:121363363-121363385 ATCACTCTTCAAACAGGGCATGG + Intergenic
1047645778 8:126868130-126868152 CTCAATTTTCAAAGCCAGAAAGG + Intergenic
1048066341 8:130973073-130973095 GTGACTTGTCAAAGAGGCAAGGG - Intronic
1049001464 8:139827978-139828000 CTCACTCATCACTGAGGGAAAGG + Intronic
1049011532 8:139890610-139890632 CTCAGTTTTCAAATACGGGAAGG + Intronic
1050905477 9:10998944-10998966 TTCACCTTTAAAAGAGTGAATGG + Intergenic
1051081018 9:13293224-13293246 GTAAATTTTAAAAGAGGGAAGGG - Intergenic
1051328502 9:15998804-15998826 TCAAATTTTCAAAGAGGGAAGGG - Intronic
1051474240 9:17486064-17486086 CACACTGTTCTAAGAGGGATAGG + Intronic
1051474257 9:17486321-17486343 CTGACTTTCCAAGAAGGGAAGGG - Intronic
1052354415 9:27489514-27489536 CTCACTATGGAAAGAGAGAAAGG + Intronic
1052785477 9:32824175-32824197 CTCTCTCTTCAAAGAGGGAAAGG - Intergenic
1055164206 9:73171818-73171840 CTCTTTTTTCAAAAAGGCAATGG + Intergenic
1055800604 9:80032107-80032129 CTCACTCATCAAAAAAGGAATGG + Intergenic
1056213739 9:84389198-84389220 CTCTCTCTTCAAAGAAGGGAAGG - Intergenic
1056503045 9:87229523-87229545 CCCACATTTCACAGTGGGAAAGG - Intergenic
1056733048 9:89182161-89182183 CTCACTTATCACCAAGGGAATGG - Intergenic
1056945870 9:90996126-90996148 TCCACTTTTCAAAGTGGGCATGG + Intergenic
1057319333 9:93997860-93997882 CTCACTTATCACCAAGGGAATGG + Intergenic
1058088964 9:100782249-100782271 TTCAATTTTCAGAGAGAGAAAGG + Intergenic
1058344664 9:103946855-103946877 CTCACTTTTCACTAAGGGGATGG + Intergenic
1059643830 9:116244199-116244221 CTCAATTTTGAAAGGGTGAAGGG + Intronic
1060382812 9:123192588-123192610 CTCAATTTTTAAAAAGGGAAAGG + Intronic
1060779840 9:126403325-126403347 CTAACTCTTCCAGGAGGGAAGGG - Intronic
1185976897 X:4731368-4731390 CTCTCTTTTTGAAGAGGGGAAGG - Intergenic
1190283668 X:48948042-48948064 CTCACTTTACAAAGGCAGAAAGG + Intronic
1191600741 X:63002449-63002471 CTCACTTTTCACCAAGGGGATGG - Intergenic
1191670689 X:63745650-63745672 CTCACTTGTAAAAAAAGGAATGG + Intronic
1191864045 X:65689679-65689701 CCCACCCTTCACAGAGGGAATGG - Intronic
1192230735 X:69263206-69263228 CTCACCGTCCAAAGAGGGAGAGG + Intergenic
1192783403 X:74316250-74316272 CTCTCTCTTCAAAGAAGGGAAGG - Intergenic
1194227833 X:91283652-91283674 CTCACACTTAAAGGAGGGAAGGG - Intergenic
1194678294 X:96819248-96819270 GTTACTTTTCAAAGAAGCAAAGG - Intronic
1194678847 X:96826892-96826914 CTCTTTTTTTAAAGAGGGAAAGG + Intronic
1195677967 X:107522005-107522027 ATCACTGTCCAAAGAGGGACTGG - Intergenic
1195791905 X:108597440-108597462 CTCACTTTTCCAGGAATGAAGGG + Exonic
1196041495 X:111209627-111209649 CTCACTTTACAAAGAGGATAGGG - Intronic
1196064033 X:111442976-111442998 CTCACTTTGCAAAACTGGAATGG + Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1197108314 X:122742577-122742599 CACATTTTTCAAAAAAGGAAAGG - Intergenic
1197609004 X:128617377-128617399 CTCACTTATCATCAAGGGAATGG + Intergenic
1198120835 X:133590968-133590990 CTGACTTTTCAAAAGTGGAAGGG + Intronic
1198427935 X:136538493-136538515 CTCACTTTCCAAAAAGGTAAAGG - Intronic
1199987735 X:152964544-152964566 CTCACTTTTCACTAAGGGGATGG + Intronic
1201859368 Y:18578806-18578828 CCCAGTTTCCAAAGAGTGAAAGG - Intronic
1201873953 Y:18741575-18741597 CCCAGTTTCCAAAGAGTGAAAGG + Intronic
1201953495 Y:19592985-19593007 TTCAATTTTATAAGAGGGAAGGG - Intergenic