ID: 1046376785

View in Genome Browser
Species Human (GRCh38)
Location 8:113393604-113393626
Sequence CTGGAGAAGGAAAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046376783_1046376785 -5 Left 1046376783 8:113393586-113393608 CCAATTCTCGTTAAGTTACTGGA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046376785 Original CRISPR CTGGAGAAGGAAAATGAGAA AGG Intronic
No off target data available for this crispr