ID: 1046390060

View in Genome Browser
Species Human (GRCh38)
Location 8:113559233-113559255
Sequence AAGATGACTTCATCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046390058_1046390060 2 Left 1046390058 8:113559208-113559230 CCTATTTGAACTTCCTACTAGAT No data
Right 1046390060 8:113559233-113559255 AAGATGACTTCATCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046390060 Original CRISPR AAGATGACTTCATCTCTCAC AGG Intergenic
No off target data available for this crispr