ID: 1046392058

View in Genome Browser
Species Human (GRCh38)
Location 8:113587508-113587530
Sequence CTCCAATGTCCTTCCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046392058_1046392066 27 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392066 8:113587558-113587580 CCATGTGAATATATGAAAGGAGG No data
1046392058_1046392062 -3 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392062 8:113587528-113587550 GAGCATAATTGAGTGAACTGGGG No data
1046392058_1046392060 -5 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392060 8:113587526-113587548 TGGAGCATAATTGAGTGAACTGG No data
1046392058_1046392067 28 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392067 8:113587559-113587581 CATGTGAATATATGAAAGGAGGG No data
1046392058_1046392063 -2 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392063 8:113587529-113587551 AGCATAATTGAGTGAACTGGGGG No data
1046392058_1046392061 -4 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392061 8:113587527-113587549 GGAGCATAATTGAGTGAACTGGG No data
1046392058_1046392064 24 Left 1046392058 8:113587508-113587530 CCCTTACAGGAAGGACATTGGAG No data
Right 1046392064 8:113587555-113587577 GAGCCATGTGAATATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046392058 Original CRISPR CTCCAATGTCCTTCCTGTAA GGG (reversed) Intergenic
No off target data available for this crispr