ID: 1046397374

View in Genome Browser
Species Human (GRCh38)
Location 8:113657654-113657676
Sequence TGTCTGAAAGGACCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046397371_1046397374 13 Left 1046397371 8:113657618-113657640 CCTGAATCAAGGGATTGAACTGA No data
Right 1046397374 8:113657654-113657676 TGTCTGAAAGGACCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046397374 Original CRISPR TGTCTGAAAGGACCACCAGG AGG Intergenic
No off target data available for this crispr