ID: 1046401106

View in Genome Browser
Species Human (GRCh38)
Location 8:113704287-113704309
Sequence CTAAGAAAACCCTACAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046401106_1046401108 15 Left 1046401106 8:113704287-113704309 CCTAAATTGTAGGGTTTTCTTAG No data
Right 1046401108 8:113704325-113704347 TTGTACTCTTCCAGAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046401106 Original CRISPR CTAAGAAAACCCTACAATTT AGG (reversed) Intergenic
No off target data available for this crispr