ID: 1046404868

View in Genome Browser
Species Human (GRCh38)
Location 8:113760254-113760276
Sequence ATCTGTGTGGTGCTCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046404865_1046404868 2 Left 1046404865 8:113760229-113760251 CCAGAACTGGGGAACCTTAATTA No data
Right 1046404868 8:113760254-113760276 ATCTGTGTGGTGCTCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046404868 Original CRISPR ATCTGTGTGGTGCTCTACAG AGG Intergenic
No off target data available for this crispr