ID: 1046406018

View in Genome Browser
Species Human (GRCh38)
Location 8:113773690-113773712
Sequence CATTACTTGCTGAAGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046406018_1046406024 19 Left 1046406018 8:113773690-113773712 CCCTTCAGCTTCAGCAAGTAATG No data
Right 1046406024 8:113773732-113773754 AATTGTTAAATGTACTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046406018 Original CRISPR CATTACTTGCTGAAGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr