ID: 1046407125

View in Genome Browser
Species Human (GRCh38)
Location 8:113789134-113789156
Sequence CTGGACATGCAGTATGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046407122_1046407125 8 Left 1046407122 8:113789103-113789125 CCATTCAAAATTTAACATTTTAC No data
Right 1046407125 8:113789134-113789156 CTGGACATGCAGTATGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046407125 Original CRISPR CTGGACATGCAGTATGTGCA TGG Intergenic
No off target data available for this crispr