ID: 1046407740

View in Genome Browser
Species Human (GRCh38)
Location 8:113796655-113796677
Sequence GTGTGTGTGGTGTGCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046407737_1046407740 -7 Left 1046407737 8:113796639-113796661 CCACTGAGTGGACTCTGTGTGTG No data
Right 1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG No data
1046407736_1046407740 -6 Left 1046407736 8:113796638-113796660 CCCACTGAGTGGACTCTGTGTGT No data
Right 1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG No data
1046407732_1046407740 19 Left 1046407732 8:113796613-113796635 CCCTGGGGACATCCTTATTAGTC No data
Right 1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG No data
1046407734_1046407740 7 Left 1046407734 8:113796625-113796647 CCTTATTAGTCTGCCCACTGAGT No data
Right 1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG No data
1046407733_1046407740 18 Left 1046407733 8:113796614-113796636 CCTGGGGACATCCTTATTAGTCT No data
Right 1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046407740 Original CRISPR GTGTGTGTGGTGTGCTCCCC GGG Intergenic
No off target data available for this crispr