ID: 1046417637

View in Genome Browser
Species Human (GRCh38)
Location 8:113937786-113937808
Sequence GACAGGTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046417637_1046417643 16 Left 1046417637 8:113937786-113937808 CCAGTAACAGGCCAAGACCTGTC No data
Right 1046417643 8:113937825-113937847 GTTGTCTGAAGAAGATGGCAGGG No data
1046417637_1046417642 15 Left 1046417637 8:113937786-113937808 CCAGTAACAGGCCAAGACCTGTC No data
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417637_1046417641 11 Left 1046417637 8:113937786-113937808 CCAGTAACAGGCCAAGACCTGTC No data
Right 1046417641 8:113937820-113937842 GAGTAGTTGTCTGAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046417637 Original CRISPR GACAGGTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr