ID: 1046417642

View in Genome Browser
Species Human (GRCh38)
Location 8:113937824-113937846
Sequence AGTTGTCTGAAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046417637_1046417642 15 Left 1046417637 8:113937786-113937808 CCAGTAACAGGCCAAGACCTGTC No data
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417636_1046417642 16 Left 1046417636 8:113937785-113937807 CCCAGTAACAGGCCAAGACCTGT No data
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417639_1046417642 4 Left 1046417639 8:113937797-113937819 CCAAGACCTGTCTCTCAAAAGGA No data
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417635_1046417642 22 Left 1046417635 8:113937779-113937801 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417640_1046417642 -2 Left 1046417640 8:113937803-113937825 CCTGTCTCTCAAAAGGAGAGTAG No data
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data
1046417634_1046417642 25 Left 1046417634 8:113937776-113937798 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046417642 Original CRISPR AGTTGTCTGAAGAAGATGGC AGG Intergenic
No off target data available for this crispr