ID: 1046418091

View in Genome Browser
Species Human (GRCh38)
Location 8:113941400-113941422
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046418088_1046418091 0 Left 1046418088 8:113941377-113941399 CCACACTGGTAGCTGATTAGATG No data
Right 1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG No data
1046418086_1046418091 17 Left 1046418086 8:113941360-113941382 CCTGCTTTATATTCTAGCCACAC No data
Right 1046418091 8:113941400-113941422 GTGCCAGCCCAGATTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046418091 Original CRISPR GTGCCAGCCCAGATTAATGG TGG Intergenic