ID: 1046424373

View in Genome Browser
Species Human (GRCh38)
Location 8:114027416-114027438
Sequence TTCTATATGAACATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046424373_1046424374 16 Left 1046424373 8:114027416-114027438 CCTTGTTCTATGTTCATATAGAA No data
Right 1046424374 8:114027455-114027477 TATAAACCAGAGTTTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046424373 Original CRISPR TTCTATATGAACATAGAACA AGG (reversed) Intergenic
No off target data available for this crispr