ID: 1046429157

View in Genome Browser
Species Human (GRCh38)
Location 8:114100418-114100440
Sequence CTGATTAAACACATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046429157_1046429163 1 Left 1046429157 8:114100418-114100440 CCCTGCCCCATGTGTTTAATCAG No data
Right 1046429163 8:114100442-114100464 TTACAAAACATATAATCACTGGG No data
1046429157_1046429162 0 Left 1046429157 8:114100418-114100440 CCCTGCCCCATGTGTTTAATCAG No data
Right 1046429162 8:114100441-114100463 TTTACAAAACATATAATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046429157 Original CRISPR CTGATTAAACACATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr