ID: 1046431601

View in Genome Browser
Species Human (GRCh38)
Location 8:114135183-114135205
Sequence ATCAGGGGCCACCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046431601_1046431614 30 Left 1046431601 8:114135183-114135205 CCTGGAGTAGGGTGGCCCCTGAT No data
Right 1046431614 8:114135236-114135258 GTATACAAGGGCACAGACTATGG No data
1046431601_1046431611 18 Left 1046431601 8:114135183-114135205 CCTGGAGTAGGGTGGCCCCTGAT No data
Right 1046431611 8:114135224-114135246 GGATCCCTGAATGTATACAAGGG No data
1046431601_1046431610 17 Left 1046431601 8:114135183-114135205 CCTGGAGTAGGGTGGCCCCTGAT No data
Right 1046431610 8:114135223-114135245 AGGATCCCTGAATGTATACAAGG No data
1046431601_1046431608 -3 Left 1046431601 8:114135183-114135205 CCTGGAGTAGGGTGGCCCCTGAT No data
Right 1046431608 8:114135203-114135225 GATGGGACAGGCCTATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046431601 Original CRISPR ATCAGGGGCCACCCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr