ID: 1046431756

View in Genome Browser
Species Human (GRCh38)
Location 8:114135969-114135991
Sequence ACTTTGTAGGGCCTAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046431756_1046431761 1 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431761 8:114135993-114136015 TCTGCAGGTGCCAGTGGCAGAGG No data
1046431756_1046431766 10 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431766 8:114136002-114136024 GCCAGTGGCAGAGGTGGTGGGGG No data
1046431756_1046431768 11 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431768 8:114136003-114136025 CCAGTGGCAGAGGTGGTGGGGGG No data
1046431756_1046431762 4 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431762 8:114135996-114136018 GCAGGTGCCAGTGGCAGAGGTGG No data
1046431756_1046431764 8 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431764 8:114136000-114136022 GTGCCAGTGGCAGAGGTGGTGGG No data
1046431756_1046431763 7 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431763 8:114135999-114136021 GGTGCCAGTGGCAGAGGTGGTGG No data
1046431756_1046431760 -5 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431760 8:114135987-114136009 AAAGTGTCTGCAGGTGCCAGTGG No data
1046431756_1046431765 9 Left 1046431756 8:114135969-114135991 CCTGTCTTTAGGCCCTACAAAGT No data
Right 1046431765 8:114136001-114136023 TGCCAGTGGCAGAGGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046431756 Original CRISPR ACTTTGTAGGGCCTAAAGAC AGG (reversed) Intergenic