ID: 1046436517

View in Genome Browser
Species Human (GRCh38)
Location 8:114196468-114196490
Sequence ACAGTTTTGGGGTTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046436517_1046436524 16 Left 1046436517 8:114196468-114196490 CCCAGCAGCAACCCCAAAACTGT No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046436517 Original CRISPR ACAGTTTTGGGGTTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr