ID: 1046436518

View in Genome Browser
Species Human (GRCh38)
Location 8:114196469-114196491
Sequence AACAGTTTTGGGGTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046436518_1046436524 15 Left 1046436518 8:114196469-114196491 CCAGCAGCAACCCCAAAACTGTT No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046436518 Original CRISPR AACAGTTTTGGGGTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr