ID: 1046436521

View in Genome Browser
Species Human (GRCh38)
Location 8:114196480-114196502
Sequence TCCTTTTGGTAAACAGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046436521_1046436527 27 Left 1046436521 8:114196480-114196502 CCCAAAACTGTTTACCAAAAGGA No data
Right 1046436527 8:114196530-114196552 AATTAACTCCAGTATCCTAGGGG No data
1046436521_1046436526 26 Left 1046436521 8:114196480-114196502 CCCAAAACTGTTTACCAAAAGGA No data
Right 1046436526 8:114196529-114196551 GAATTAACTCCAGTATCCTAGGG No data
1046436521_1046436524 4 Left 1046436521 8:114196480-114196502 CCCAAAACTGTTTACCAAAAGGA No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436521_1046436525 25 Left 1046436521 8:114196480-114196502 CCCAAAACTGTTTACCAAAAGGA No data
Right 1046436525 8:114196528-114196550 GGAATTAACTCCAGTATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046436521 Original CRISPR TCCTTTTGGTAAACAGTTTT GGG (reversed) Intergenic
No off target data available for this crispr