ID: 1046436523

View in Genome Browser
Species Human (GRCh38)
Location 8:114196494-114196516
Sequence GCAAATAACTATTCTCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046436523_1046436524 -10 Left 1046436523 8:114196494-114196516 CCAAAAGGAGAATAGTTATTTGC No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436523_1046436525 11 Left 1046436523 8:114196494-114196516 CCAAAAGGAGAATAGTTATTTGC No data
Right 1046436525 8:114196528-114196550 GGAATTAACTCCAGTATCCTAGG No data
1046436523_1046436526 12 Left 1046436523 8:114196494-114196516 CCAAAAGGAGAATAGTTATTTGC No data
Right 1046436526 8:114196529-114196551 GAATTAACTCCAGTATCCTAGGG No data
1046436523_1046436527 13 Left 1046436523 8:114196494-114196516 CCAAAAGGAGAATAGTTATTTGC No data
Right 1046436527 8:114196530-114196552 AATTAACTCCAGTATCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046436523 Original CRISPR GCAAATAACTATTCTCCTTT TGG (reversed) Intergenic
No off target data available for this crispr