ID: 1046436524

View in Genome Browser
Species Human (GRCh38)
Location 8:114196507-114196529
Sequence AGTTATTTGCAGAAGATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046436522_1046436524 3 Left 1046436522 8:114196481-114196503 CCAAAACTGTTTACCAAAAGGAG No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436523_1046436524 -10 Left 1046436523 8:114196494-114196516 CCAAAAGGAGAATAGTTATTTGC No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436517_1046436524 16 Left 1046436517 8:114196468-114196490 CCCAGCAGCAACCCCAAAACTGT No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436518_1046436524 15 Left 1046436518 8:114196469-114196491 CCAGCAGCAACCCCAAAACTGTT No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436521_1046436524 4 Left 1046436521 8:114196480-114196502 CCCAAAACTGTTTACCAAAAGGA No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data
1046436519_1046436524 5 Left 1046436519 8:114196479-114196501 CCCCAAAACTGTTTACCAAAAGG No data
Right 1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046436524 Original CRISPR AGTTATTTGCAGAAGATGCT AGG Intergenic
No off target data available for this crispr