ID: 1046437323

View in Genome Browser
Species Human (GRCh38)
Location 8:114208390-114208412
Sequence GTTGAATTGCTGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046437323_1046437325 -3 Left 1046437323 8:114208390-114208412 CCTGCTTCCTTCAGCAATTCAAC No data
Right 1046437325 8:114208410-114208432 AACTTTTTTACCACTGCATGTGG No data
1046437323_1046437328 15 Left 1046437323 8:114208390-114208412 CCTGCTTCCTTCAGCAATTCAAC No data
Right 1046437328 8:114208428-114208450 TGTGGATTACACTTACATTTGGG No data
1046437323_1046437327 14 Left 1046437323 8:114208390-114208412 CCTGCTTCCTTCAGCAATTCAAC No data
Right 1046437327 8:114208427-114208449 ATGTGGATTACACTTACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046437323 Original CRISPR GTTGAATTGCTGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr