ID: 1046439527

View in Genome Browser
Species Human (GRCh38)
Location 8:114239997-114240019
Sequence TTTGAGAAGCTGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7848
Summary {0: 3, 1: 49, 2: 494, 3: 2067, 4: 5235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046439522_1046439527 13 Left 1046439522 8:114239961-114239983 CCAGCATGGTAGCTTATGGCTAT No data
Right 1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG 0: 3
1: 49
2: 494
3: 2067
4: 5235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046439527 Original CRISPR TTTGAGAAGCTGAGGCAGGA AGG Intergenic
Too many off-targets to display for this crispr