ID: 1046440838

View in Genome Browser
Species Human (GRCh38)
Location 8:114252100-114252122
Sequence TTGGGTTTAAAAAATTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046440838_1046440844 4 Left 1046440838 8:114252100-114252122 CCCGACCAATTTTTTAAACCCAA No data
Right 1046440844 8:114252127-114252149 TCTTGTATGCTGTAGCTGCAGGG No data
1046440838_1046440843 3 Left 1046440838 8:114252100-114252122 CCCGACCAATTTTTTAAACCCAA No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046440838 Original CRISPR TTGGGTTTAAAAAATTGGTC GGG (reversed) Intergenic
No off target data available for this crispr