ID: 1046440839

View in Genome Browser
Species Human (GRCh38)
Location 8:114252101-114252123
Sequence ATTGGGTTTAAAAAATTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046440839_1046440843 2 Left 1046440839 8:114252101-114252123 CCGACCAATTTTTTAAACCCAAT No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data
1046440839_1046440844 3 Left 1046440839 8:114252101-114252123 CCGACCAATTTTTTAAACCCAAT No data
Right 1046440844 8:114252127-114252149 TCTTGTATGCTGTAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046440839 Original CRISPR ATTGGGTTTAAAAAATTGGT CGG (reversed) Intergenic
No off target data available for this crispr