ID: 1046440843

View in Genome Browser
Species Human (GRCh38)
Location 8:114252126-114252148
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046440840_1046440843 -2 Left 1046440840 8:114252105-114252127 CCAATTTTTTAAACCCAATTAGT No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data
1046440839_1046440843 2 Left 1046440839 8:114252101-114252123 CCGACCAATTTTTTAAACCCAAT No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data
1046440836_1046440843 11 Left 1046440836 8:114252092-114252114 CCACCGCGCCCGACCAATTTTTT No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data
1046440837_1046440843 8 Left 1046440837 8:114252095-114252117 CCGCGCCCGACCAATTTTTTAAA No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data
1046440838_1046440843 3 Left 1046440838 8:114252100-114252122 CCCGACCAATTTTTTAAACCCAA No data
Right 1046440843 8:114252126-114252148 GTCTTGTATGCTGTAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046440843 Original CRISPR GTCTTGTATGCTGTAGCTGC AGG Intergenic
No off target data available for this crispr