ID: 1046446492

View in Genome Browser
Species Human (GRCh38)
Location 8:114327671-114327693
Sequence CAATATATGAAAATCCAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046446492_1046446494 19 Left 1046446492 8:114327671-114327693 CCACGTTGGATTTTCATATATTG No data
Right 1046446494 8:114327713-114327735 CTTTTTTTTTTTTTTTTTTTGGG 0: 1303
1: 15922
2: 19091
3: 34787
4: 81686
1046446492_1046446493 18 Left 1046446492 8:114327671-114327693 CCACGTTGGATTTTCATATATTG No data
Right 1046446493 8:114327712-114327734 TCTTTTTTTTTTTTTTTTTTTGG 0: 843
1: 15463
2: 19308
3: 33435
4: 76723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046446492 Original CRISPR CAATATATGAAAATCCAACG TGG (reversed) Intergenic
No off target data available for this crispr