ID: 1046448837

View in Genome Browser
Species Human (GRCh38)
Location 8:114360320-114360342
Sequence CCACATAAACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046448831_1046448837 11 Left 1046448831 8:114360286-114360308 CCGTCTTCGAGAAACTCATCTAA No data
Right 1046448837 8:114360320-114360342 CCACATAAACTTAAGGTAAAGGG No data
1046448829_1046448837 29 Left 1046448829 8:114360268-114360290 CCACCAACAAAGTATCTACCGTC No data
Right 1046448837 8:114360320-114360342 CCACATAAACTTAAGGTAAAGGG No data
1046448830_1046448837 26 Left 1046448830 8:114360271-114360293 CCAACAAAGTATCTACCGTCTTC No data
Right 1046448837 8:114360320-114360342 CCACATAAACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046448837 Original CRISPR CCACATAAACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr