ID: 1046449795

View in Genome Browser
Species Human (GRCh38)
Location 8:114373281-114373303
Sequence ACTTCTTAGCCCATTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046449795_1046449797 11 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449797 8:114373315-114373337 GTTTAGCCAAGGACATAGTCTGG No data
1046449795_1046449798 12 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449798 8:114373316-114373338 TTTAGCCAAGGACATAGTCTGGG No data
1046449795_1046449796 0 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449796 8:114373304-114373326 GAGTTGACTCTGTTTAGCCAAGG No data
1046449795_1046449800 17 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449800 8:114373321-114373343 CCAAGGACATAGTCTGGGAGAGG No data
1046449795_1046449801 18 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449801 8:114373322-114373344 CAAGGACATAGTCTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046449795 Original CRISPR ACTTCTTAGCCCATTTGCTT TGG (reversed) Intergenic
No off target data available for this crispr