ID: 1046449797

View in Genome Browser
Species Human (GRCh38)
Location 8:114373315-114373337
Sequence GTTTAGCCAAGGACATAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046449795_1046449797 11 Left 1046449795 8:114373281-114373303 CCAAAGCAAATGGGCTAAGAAGT No data
Right 1046449797 8:114373315-114373337 GTTTAGCCAAGGACATAGTCTGG No data
1046449794_1046449797 18 Left 1046449794 8:114373274-114373296 CCTTCATCCAAAGCAAATGGGCT No data
Right 1046449797 8:114373315-114373337 GTTTAGCCAAGGACATAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046449797 Original CRISPR GTTTAGCCAAGGACATAGTC TGG Intergenic
No off target data available for this crispr