ID: 1046450393

View in Genome Browser
Species Human (GRCh38)
Location 8:114383090-114383112
Sequence GAAGATGCCCAGAGGCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046450389_1046450393 -4 Left 1046450389 8:114383071-114383093 CCATGAAGGGGTCCAAAAGGAAG No data
Right 1046450393 8:114383090-114383112 GAAGATGCCCAGAGGCTTATGGG No data
1046450387_1046450393 2 Left 1046450387 8:114383065-114383087 CCTGTTCCATGAAGGGGTCCAAA No data
Right 1046450393 8:114383090-114383112 GAAGATGCCCAGAGGCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046450393 Original CRISPR GAAGATGCCCAGAGGCTTAT GGG Intergenic
No off target data available for this crispr