ID: 1046466915

View in Genome Browser
Species Human (GRCh38)
Location 8:114616908-114616930
Sequence TAATCGATATACAACTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046466913_1046466915 -10 Left 1046466913 8:114616895-114616917 CCTAACCAACTAATAATCGATAT No data
Right 1046466915 8:114616908-114616930 TAATCGATATACAACTTGAGTGG No data
1046466912_1046466915 17 Left 1046466912 8:114616868-114616890 CCAAGAAAAAACAATGTGAAAGA No data
Right 1046466915 8:114616908-114616930 TAATCGATATACAACTTGAGTGG No data
1046466911_1046466915 25 Left 1046466911 8:114616860-114616882 CCTGGGTACCAAGAAAAAACAAT No data
Right 1046466915 8:114616908-114616930 TAATCGATATACAACTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046466915 Original CRISPR TAATCGATATACAACTTGAG TGG Intergenic
No off target data available for this crispr