ID: 1046468634

View in Genome Browser
Species Human (GRCh38)
Location 8:114638502-114638524
Sequence TTATTAATGAATAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046468631_1046468634 3 Left 1046468631 8:114638476-114638498 CCATGTAAGCATCTTTTATTTAT No data
Right 1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG No data
1046468629_1046468634 27 Left 1046468629 8:114638452-114638474 CCAATAAGCAAGTCCTATTTGAA No data
Right 1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG No data
1046468630_1046468634 14 Left 1046468630 8:114638465-114638487 CCTATTTGAAGCCATGTAAGCAT No data
Right 1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046468634 Original CRISPR TTATTAATGAATAAGGAAGA GGG Intergenic
No off target data available for this crispr