ID: 1046468924

View in Genome Browser
Species Human (GRCh38)
Location 8:114642794-114642816
Sequence CCTGCGAGGCAGAGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046468924_1046468930 1 Left 1046468924 8:114642794-114642816 CCCTCCAACCTCTGCCTCGCAGG No data
Right 1046468930 8:114642818-114642840 TCAAGCAGCTCTCCTGCCTCAGG No data
1046468924_1046468935 17 Left 1046468924 8:114642794-114642816 CCCTCCAACCTCTGCCTCGCAGG No data
Right 1046468935 8:114642834-114642856 CCTCAGGCTCCCAGGTAGCTGGG 0: 51
1: 4635
2: 107624
3: 215581
4: 252403
1046468924_1046468931 9 Left 1046468924 8:114642794-114642816 CCCTCCAACCTCTGCCTCGCAGG No data
Right 1046468931 8:114642826-114642848 CTCTCCTGCCTCAGGCTCCCAGG No data
1046468924_1046468933 16 Left 1046468924 8:114642794-114642816 CCCTCCAACCTCTGCCTCGCAGG No data
Right 1046468933 8:114642833-114642855 GCCTCAGGCTCCCAGGTAGCTGG 0: 37
1: 3683
2: 94015
3: 203045
4: 240381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046468924 Original CRISPR CCTGCGAGGCAGAGGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr