ID: 1046481196

View in Genome Browser
Species Human (GRCh38)
Location 8:114821136-114821158
Sequence CACAGGGATGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046481196_1046481202 -2 Left 1046481196 8:114821136-114821158 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1046481202 8:114821157-114821179 TGGCTTTGCACTGTTGGCTTTGG No data
1046481196_1046481204 14 Left 1046481196 8:114821136-114821158 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1046481204 8:114821173-114821195 GCTTTGGAGGTCACTCTCACAGG No data
1046481196_1046481203 1 Left 1046481196 8:114821136-114821158 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1046481203 8:114821160-114821182 CTTTGCACTGTTGGCTTTGGAGG No data
1046481196_1046481199 -8 Left 1046481196 8:114821136-114821158 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1046481199 8:114821151-114821173 TCCCTGTGGCTTTGCACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046481196 Original CRISPR CACAGGGATGGAGCTGCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr