ID: 1046485293

View in Genome Browser
Species Human (GRCh38)
Location 8:114879726-114879748
Sequence CTGTGTAAACAGACTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046485293_1046485295 -1 Left 1046485293 8:114879726-114879748 CCTTGAACAGTCTGTTTACACAG No data
Right 1046485295 8:114879748-114879770 GGAAAAATTTATTCAAGACATGG No data
1046485293_1046485296 11 Left 1046485293 8:114879726-114879748 CCTTGAACAGTCTGTTTACACAG No data
Right 1046485296 8:114879760-114879782 TCAAGACATGGAACTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046485293 Original CRISPR CTGTGTAAACAGACTGTTCA AGG (reversed) Intergenic
No off target data available for this crispr