ID: 1046487144

View in Genome Browser
Species Human (GRCh38)
Location 8:114901550-114901572
Sequence ATACCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046487144_1046487146 1 Left 1046487144 8:114901550-114901572 CCTTCACTCTTCTAGAAGGGTAT No data
Right 1046487146 8:114901574-114901596 ATTTTTTAGGTCCTCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046487144 Original CRISPR ATACCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr