ID: 1046487146

View in Genome Browser
Species Human (GRCh38)
Location 8:114901574-114901596
Sequence ATTTTTTAGGTCCTCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046487144_1046487146 1 Left 1046487144 8:114901550-114901572 CCTTCACTCTTCTAGAAGGGTAT No data
Right 1046487146 8:114901574-114901596 ATTTTTTAGGTCCTCTTCTGTGG No data
1046487141_1046487146 9 Left 1046487141 8:114901542-114901564 CCAGGAGGCCTTCACTCTTCTAG 0: 27
1: 53
2: 45
3: 55
4: 162
Right 1046487146 8:114901574-114901596 ATTTTTTAGGTCCTCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046487146 Original CRISPR ATTTTTTAGGTCCTCTTCTG TGG Intergenic
No off target data available for this crispr