ID: 1046489555

View in Genome Browser
Species Human (GRCh38)
Location 8:114932303-114932325
Sequence ATGTTGAAACAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046489555_1046489558 25 Left 1046489555 8:114932303-114932325 CCCTCCTCTTTCTGTTTCAACAT No data
Right 1046489558 8:114932351-114932373 CTTTCTAGTTGTAGTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046489555 Original CRISPR ATGTTGAAACAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr