ID: 1046489558

View in Genome Browser
Species Human (GRCh38)
Location 8:114932351-114932373
Sequence CTTTCTAGTTGTAGTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046489555_1046489558 25 Left 1046489555 8:114932303-114932325 CCCTCCTCTTTCTGTTTCAACAT No data
Right 1046489558 8:114932351-114932373 CTTTCTAGTTGTAGTGTCACAGG No data
1046489557_1046489558 21 Left 1046489557 8:114932307-114932329 CCTCTTTCTGTTTCAACATTTAC No data
Right 1046489558 8:114932351-114932373 CTTTCTAGTTGTAGTGTCACAGG No data
1046489556_1046489558 24 Left 1046489556 8:114932304-114932326 CCTCCTCTTTCTGTTTCAACATT No data
Right 1046489558 8:114932351-114932373 CTTTCTAGTTGTAGTGTCACAGG No data
1046489554_1046489558 26 Left 1046489554 8:114932302-114932324 CCCCTCCTCTTTCTGTTTCAACA No data
Right 1046489558 8:114932351-114932373 CTTTCTAGTTGTAGTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046489558 Original CRISPR CTTTCTAGTTGTAGTGTCAC AGG Intergenic
No off target data available for this crispr