ID: 1046489790

View in Genome Browser
Species Human (GRCh38)
Location 8:114936572-114936594
Sequence CCTCTGACTGCAGCTGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046489790_1046489793 -8 Left 1046489790 8:114936572-114936594 CCTTTACCAGCTGCAGTCAGAGG No data
Right 1046489793 8:114936587-114936609 GTCAGAGGAAGATGTGACTATGG No data
1046489790_1046489795 -4 Left 1046489790 8:114936572-114936594 CCTTTACCAGCTGCAGTCAGAGG No data
Right 1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG No data
1046489790_1046489796 24 Left 1046489790 8:114936572-114936594 CCTTTACCAGCTGCAGTCAGAGG No data
Right 1046489796 8:114936619-114936641 TAAAAAGACACAAGATGAAAAGG No data
1046489790_1046489794 -7 Left 1046489790 8:114936572-114936594 CCTTTACCAGCTGCAGTCAGAGG No data
Right 1046489794 8:114936588-114936610 TCAGAGGAAGATGTGACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046489790 Original CRISPR CCTCTGACTGCAGCTGGTAA AGG (reversed) Intergenic
No off target data available for this crispr