ID: 1046489792

View in Genome Browser
Species Human (GRCh38)
Location 8:114936578-114936600
Sequence CATCTTCCTCTGACTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046489792_1046489795 -10 Left 1046489792 8:114936578-114936600 CCAGCTGCAGTCAGAGGAAGATG No data
Right 1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG No data
1046489792_1046489796 18 Left 1046489792 8:114936578-114936600 CCAGCTGCAGTCAGAGGAAGATG No data
Right 1046489796 8:114936619-114936641 TAAAAAGACACAAGATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046489792 Original CRISPR CATCTTCCTCTGACTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr