ID: 1046494960

View in Genome Browser
Species Human (GRCh38)
Location 8:115001181-115001203
Sequence GTGAAGGCCCAGAATTATTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046494957_1046494960 29 Left 1046494957 8:115001129-115001151 CCATTAACGGAGTTTGAGGATTC No data
Right 1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046494960 Original CRISPR GTGAAGGCCCAGAATTATTA CGG Intergenic
No off target data available for this crispr