ID: 1046497947

View in Genome Browser
Species Human (GRCh38)
Location 8:115038256-115038278
Sequence AACCCGGTGCTGTCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046497947_1046497949 0 Left 1046497947 8:115038256-115038278 CCTGCTTGTGACAGCACCGGGTT No data
Right 1046497949 8:115038279-115038301 CATTCAAATCATTCAGCATTTGG No data
1046497947_1046497950 18 Left 1046497947 8:115038256-115038278 CCTGCTTGTGACAGCACCGGGTT No data
Right 1046497950 8:115038297-115038319 TTTGGTCGAATGTCAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046497947 Original CRISPR AACCCGGTGCTGTCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr