ID: 1046500551

View in Genome Browser
Species Human (GRCh38)
Location 8:115070858-115070880
Sequence CTGCGGGTCAAGCAGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046500551_1046500556 28 Left 1046500551 8:115070858-115070880 CCTTCTGACTGCTTGACCCGCAG No data
Right 1046500556 8:115070909-115070931 AACTTAAACATCACCTCTTCTGG No data
1046500551_1046500554 -1 Left 1046500551 8:115070858-115070880 CCTTCTGACTGCTTGACCCGCAG No data
Right 1046500554 8:115070880-115070902 GTATTGCTCTTTTTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046500551 Original CRISPR CTGCGGGTCAAGCAGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr