ID: 1046501929

View in Genome Browser
Species Human (GRCh38)
Location 8:115088859-115088881
Sequence CTAGTTTATCAAGGATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046501926_1046501929 -6 Left 1046501926 8:115088842-115088864 CCATTGGATTGCCTTTGCTAGTT No data
Right 1046501929 8:115088859-115088881 CTAGTTTATCAAGGATCAGCTGG No data
1046501924_1046501929 21 Left 1046501924 8:115088815-115088837 CCATTTGTTGAAAATACTCTCTT No data
Right 1046501929 8:115088859-115088881 CTAGTTTATCAAGGATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046501929 Original CRISPR CTAGTTTATCAAGGATCAGC TGG Intergenic
No off target data available for this crispr