ID: 1046502175

View in Genome Browser
Species Human (GRCh38)
Location 8:115092864-115092886
Sequence CACCTTTTGTAGTTGGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046502170_1046502175 21 Left 1046502170 8:115092820-115092842 CCCTTTTTTAAAATCCATCTGGT No data
Right 1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG No data
1046502171_1046502175 20 Left 1046502171 8:115092821-115092843 CCTTTTTTAAAATCCATCTGGTA No data
Right 1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG No data
1046502172_1046502175 7 Left 1046502172 8:115092834-115092856 CCATCTGGTATTTTCATTTTGCC No data
Right 1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046502175 Original CRISPR CACCTTTTGTAGTTGGCCCA CGG Intergenic
No off target data available for this crispr