ID: 1046502229

View in Genome Browser
Species Human (GRCh38)
Location 8:115093506-115093528
Sequence CTCACCACTTAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046502221_1046502229 1 Left 1046502221 8:115093482-115093504 CCTAACACATGCTTCTCAACCCT No data
Right 1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG No data
1046502220_1046502229 16 Left 1046502220 8:115093467-115093489 CCTCTGAATTGTGAACCTAACAC No data
Right 1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG No data
1046502219_1046502229 22 Left 1046502219 8:115093461-115093483 CCTGTACCTCTGAATTGTGAACC No data
Right 1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046502229 Original CRISPR CTCACCACTTAGATGGGGCA GGG Intergenic
No off target data available for this crispr