ID: 1046503021

View in Genome Browser
Species Human (GRCh38)
Location 8:115102820-115102842
Sequence ATGTATGTGGTTAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046503015_1046503021 15 Left 1046503015 8:115102782-115102804 CCAAATGGTTTCAAATGGTTCTT No data
Right 1046503021 8:115102820-115102842 ATGTATGTGGTTAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046503021 Original CRISPR ATGTATGTGGTTAAAGAGGA TGG Intergenic
No off target data available for this crispr